View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19930_low_38 (Length: 237)

Name: NF19930_low_38
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19930_low_38
NF19930_low_38
[»] chr6 (1 HSPs)
chr6 (1-221)||(6945786-6946006)


Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 6946006 - 6945786
Alignment:
1 gcaaattgtcaagatgtgaaggtggtggaggtgtgggaaaggaatgcggttggagagagatgggggcttcgttggtgtagagacttgtttgtgtgggaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6946006 gcaaattgtcaagatgtgaaggtggtggaggtgtgggaaaggaatgcggttggagagagatgggggcttcgttggtgtagagacttgtttgtgtgggaaa 6945907  T
101 gggagcttgtgaatgctcttataacaaggggtggtggtaagggagggagtggattcgaggtcttggaagccggaggagggatgggtttttaccgtcaagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6945906 gggagcttgtgaatgctcttataacaaggggtggtggtaagggagggagtggattcgaggtcttggaagccggaggagggatgggtttttaccgtcaagt 6945807  T
201 cttgttatttattgttacaag 221  Q
    |||||||||||||||||||||    
6945806 cttgttatttattgttacaag 6945786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University