View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19930_low_41 (Length: 223)
Name: NF19930_low_41
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19930_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 22 - 205
Target Start/End: Original strand, 39036669 - 39036850
Alignment:
| Q |
22 |
atagtagtacgtaccatgcaatataattcagctcccctaaggtagcaatattaatacagagttacatagacnnnnnnngagaatgttttatttaatttca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39036669 |
atagtagtacgtaccatgcaatataattcagctcccctaaggtagcaatat--atacagagttacatagacaaaaaaagagaatgttttatttaatttca |
39036766 |
T |
 |
| Q |
122 |
ctggatacacaacaacgttatgaatttaacaaccagatggagaaagagttatgataacccttatgagtgatggtgtggtgttag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39036767 |
ctggatacacaacaacgttatgaatttaacaaccagatggagaaagagttatgataacccttatgagtgatggtgtggtgttag |
39036850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University