View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19930_low_44 (Length: 209)
Name: NF19930_low_44
Description: NF19930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19930_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 5474863 - 5475045
Alignment:
| Q |
11 |
agtgagatgaaaatcaagagactagcatgcatatattagatnnnnnnnnnnnnngaacgtgtcctattacatgaaacttcaagctcagaatgatggtgga |
110 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5474863 |
agtgaaataaaaatcaagagactagcatgcatatattagataaaaaaacaaaaagaacgtgtcctattacatgaaacttcaagctcagaatgatggtgga |
5474962 |
T |
 |
| Q |
111 |
gtggaagtactgaagtagccacttcataccagacgtgtctactctctagagcaagccttcaacaaaataaggagctagctatc |
193 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5474963 |
gtagaagtactgaagtagccacttcataccagacgtgtctactctctagagcaagccttcaacaaaataaggagctagctatc |
5475045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University