View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19931_high_10 (Length: 218)
Name: NF19931_high_10
Description: NF19931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19931_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 44038538 - 44038740
Alignment:
| Q |
1 |
ttacctaactaagaaatatgtctctacatttgtacaaagaatctggatttgaatt-catttcgctaaatttcccttaaagcaactaaaatgctttaagtt |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| | ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44038538 |
ttacctaactaagaaatctgtctctacatttgcacaaagaacccggatttgaatttcatttcgctaaatttcccttaacgcaactaaaatgctttaagtt |
44038637 |
T |
 |
| Q |
100 |
atcgcgatttagacctgtaatgtaaatcatatcatttgtaatggtgtagtccggtgcttccccttgcagtagcttgaggttggcatgcctattaggtaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44038638 |
atcgcgatttagacctgtaatgtaaatcatatcatttgtaatggtgtagtccggtgcttccccttgcagtagattgaggttggcatgcctattaggtaaa |
44038737 |
T |
 |
| Q |
200 |
act |
202 |
Q |
| |
|
||| |
|
|
| T |
44038738 |
act |
44038740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University