View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19931_high_4 (Length: 330)
Name: NF19931_high_4
Description: NF19931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19931_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 31141092 - 31140778
Alignment:
| Q |
1 |
attttgaagaaagagtgatgtagggtcagtgacacttgtatctatgtcccaaaggatatccttcttacacatatgagta-aagagatggaattgatggat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31141092 |
attttgaagaaagagtgatgtagggtcagtgacacttgtatctatgtcccaaaggatatccttcttacacatatgagtagaagagatggaattgatggat |
31140993 |
T |
 |
| Q |
100 |
gcagatcgagaaagaaacaaatttgcggtaggttgagttgaaacaaaatttgtatttcatgatgatgaatcgaagtatagaaaagtcatagtaaaacttc |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
31140992 |
gcagattgagaaagaaacaaatttgcggtaggttgagttgaaacaaaatttgtatttcatgatgatgaatcaaagtatagaaacgtcgtagtaaaacttc |
31140893 |
T |
 |
| Q |
200 |
tatacttaagtactacccggacatatacctctttctttgcccgatgattgagtcaacatgtctccaaaagtcaacaagttcactaccaggccgccattac |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31140892 |
tatacttaagtactacccggacatatacctctttctttgcccgatgattgagtcaacatgtctccaaaagtcaacaagttcactaccaggccgccattac |
31140793 |
T |
 |
| Q |
300 |
aatgttacagcatct |
314 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31140792 |
aatgttacagcatct |
31140778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University