View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19931_low_5 (Length: 328)
Name: NF19931_low_5
Description: NF19931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19931_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 313
Target Start/End: Complemental strand, 51987797 - 51987508
Alignment:
| Q |
18 |
cctatctctttgaattgaggcattcctatgagattcgctcttgaaaaagagttcatgtgttttttcatctctataaatgtgtttgtgaagtccacaagga |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51987797 |
cctatctcttcgaattgaggcattcctatgagattcgctcttgaaaaagagttcatgtgttttttcatctctataaatgtgtttgtgaagtccacaagga |
51987698 |
T |
 |
| Q |
118 |
ggttgaacatattttgctgcagttaaggcaaagattacggcaatctcttcgtcgaaaaaatcgttgtcctttagtcgttctatggtagaatctatgtcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51987697 |
ggttgaacatattttgctgcagttaaggcaaagattacggcaatctcttcgtcggaaaaatcgttgtcctttagtcgttctatggtagaatctatgtcac |
51987598 |
T |
 |
| Q |
218 |
tatctggagggacaaaagaattggaagagggaggttgttcttgttcttgttctcgttctcgttcttgttgagagggagtgagagtttcttgagtat |
313 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51987597 |
taactggagggacaaaagaattggaagagggaggttgttcttgttcttgttctcg------ttcttgttgagagggagtgagggtttcttgagtat |
51987508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University