View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19931_low_9 (Length: 228)
Name: NF19931_low_9
Description: NF19931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19931_low_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 44038091 - 44038328
Alignment:
| Q |
1 |
aatgattgtttcatttagagtttgaatttgttttctctcaaacaattcatctttaactaa----------ccatttcaataatcatttgattaacatata |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44038091 |
aatgattgtttcatttagagtttgaatttgttttctctcaaacaattcatctttaactaatgtttattaaccatttcaataatcatttgattaacatata |
44038190 |
T |
 |
| Q |
91 |
ctacctccgtcgttaaatataaaattcgtttgagtttctctttattccttttataagactctctttgaattgtcaaatgcattgattatttttctgtgaa |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44038191 |
ctacctccgtcgttaaatataaaattcgtttgagtttctctttattccttttataagactctctttgaattgtcaaatgcattgattatttttctgtgga |
44038290 |
T |
 |
| Q |
191 |
catgataaatannnnnnnacgaaaaatacaattatacc |
228 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
44038291 |
aatgataaataggaggggacgaaaaatacaattatacc |
44038328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University