View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_high_28 (Length: 331)
Name: NF19932_high_28
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 36 - 223
Target Start/End: Original strand, 3619143 - 3619330
Alignment:
| Q |
36 |
gtaattaaattgtttatcaaaacaggtcttaatcatgtcatgtggaattgagaaaaatgcaggcggattttcctaattgccattgctaatttttaatcta |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3619143 |
gtaattaaattgtttatcaaaacaggtcttaataatgtcatattgaattgagaaaaatgcaggcggattttcctaattgccattgctaatttttaatcta |
3619242 |
T |
|
| Q |
136 |
cgtcccctacagttgttctcattttcacttctgtttaatataatcttagtgctattgtatagtagtagatattttggtcagttacttg |
223 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3619243 |
cgtcccctaccgttgttctcattttcacttctgtttaatataatcttagtgctattgtatagtagtagatattttggtcacttacttg |
3619330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 237 - 318
Target Start/End: Original strand, 3619388 - 3619469
Alignment:
| Q |
237 |
caaactatgaaggtgacattaatatttagaattcctctattggaagcaagtagaaacagaatggaaaaattgattatttcat |
318 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3619388 |
caaactatgaagatgacattaatatttagaattcctctattggaagcaagtagaaacagaatggaaaaattgattatttcat |
3619469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University