View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_high_29 (Length: 321)
Name: NF19932_high_29
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 119 - 308
Target Start/End: Original strand, 16610454 - 16610638
Alignment:
| Q |
119 |
acaatgaaggaagttgatgagtttgacattgtaattaattagggtaatggattgattaaaactagggttgatttaaggttatggttttgaatatgatttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16610454 |
acaatgaaggaagttgatgagtttgacattgtaattaattagggtaatggattgattaaaactagggttgatttaaggttatggttttgaatatgatttt |
16610553 |
T |
|
| Q |
219 |
gttggaatgagagggatttatagatgaagaaattaagtggaggaaacgtaaatgccatgggtttagaacgtgacttgtaggatggaactg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16610554 |
gttggaatgagagggatttatagatgaagaaattaagttgaggaaacgtaa-----atgggtttagaacgtgacttgtaggatggaactg |
16610638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University