View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_high_52 (Length: 229)
Name: NF19932_high_52
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_high_52 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 34747517 - 34747739
Alignment:
| Q |
1 |
tttaatcttcatcctatctctgctaattacattttatacaataactaatttacttgttaagctttcatttggaaaaattgcatggttgtttcttacttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34747517 |
tttaatcttcatcctatctctgctaattacattttatacaataactaatttacttgttaagctttcatttggaaaaattgcatggttggttcttacttat |
34747616 |
T |
 |
| Q |
101 |
tgagttgcagttgcagtgttttgtctcttctatgcacatgcctttttgttggattttggcctcattgattattcccatttacactcataatctcattttc |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34747617 |
tgagtt------gcagtgttttgtctcttctatgcacatgcctttttgttggattttggcctcattgattattcccatttacactcataatctcattttc |
34747710 |
T |
 |
| Q |
201 |
taccccaaaaatacaccttgctcctttta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34747711 |
taccccaaaaatacaccttgctcctttta |
34747739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University