View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_high_53 (Length: 228)
Name: NF19932_high_53
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_high_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 32431120 - 32430923
Alignment:
| Q |
16 |
atgtcataaaattgttgtcattattcccaaccaaacaaatgttagatatgtcattttcgttcttgtatattaataatattaaagtagtcattatccacca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32431120 |
atgtcataaaattgttgtcattattcccaaccaaacaaatgttagatatgtcattttcgttcttgtatattaataatattaaagtagtcattatccacca |
32431021 |
T |
|
| Q |
116 |
caattgnnnnnnnnnnnnnnnnnttgaagatatgattttcatacatcctccaaaataataggcgaatactaaattagggctatatattagtattgtat |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32431020 |
caattgaaaaaaataataaaaaattgaagatatgattttcatacatcctccaaaataataggcgaatactaaattagggctatatattagtattgtat |
32430923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University