View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_low_36 (Length: 300)
Name: NF19932_low_36
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 227 - 290
Target Start/End: Original strand, 15155368 - 15155431
Alignment:
| Q |
227 |
cgatgctcgcgagtgtttgggactaggttattgcgatggtttccacacttttttatacaatatt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
15155368 |
cgatgctcgcgagtgtttgggactaggttattgtgatggttttcacacttttttatacaatatt |
15155431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University