View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_low_42 (Length: 278)
Name: NF19932_low_42
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 4 - 261
Target Start/End: Original strand, 2787743 - 2787983
Alignment:
| Q |
4 |
tttttctccatgataaaaatgcaatttgttaaattttatgaaactaaattgattcnnnnnnngtcggtctacttctttggtcgaaacaaccatcgtcatc |
103 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2787743 |
tttttctccatgacaaaaatgcaatttgttaaattttatgaaactaaattgattctttttttgtcggtctacttctttggtcaaaacaaccatcgtcatc |
2787842 |
T |
 |
| Q |
104 |
actgacactgatactcacaaaaaatgggaaatagaagggtgtgtgaggaaatgtaagaagaaaaccgaaatataagattaatcatatttttgggactata |
203 |
Q |
| |
|
| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || | |
|
|
| T |
2787843 |
attgaaactgatactcacaaaaaatgggaaatagaagggtgtgtgaggaaatgtaagaagaaaaccgaaatataa-----------------ggcttaaa |
2787925 |
T |
 |
| Q |
204 |
ccagattgtgccctaacacttgattattcatcacttccaggtctttatccctcaccat |
261 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2787926 |
tcagattgtgccataacacttgattattcatcacttccaggtctttatccctcaccat |
2787983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 232 - 261
Target Start/End: Original strand, 22363679 - 22363708
Alignment:
| Q |
232 |
catcacttccaggtctttatccctcaccat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22363679 |
catcacttccaggtctttatccctcaccat |
22363708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University