View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_low_45 (Length: 268)
Name: NF19932_low_45
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 44913983 - 44913736
Alignment:
| Q |
1 |
ggtgtgtgaaaatttattgtgaatgaattgatttggtaaacttgatttgagtgtgaaatagtttatgtttggatatatttgcattttgcataaatgagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44913983 |
ggtgtgtgaaaatttattgtgaatgaattgatttggtaaacttgatttgagtgtgaaatagtttatgtttggatatatttgcattttgcataaatgagtt |
44913884 |
T |
|
| Q |
101 |
gaacaataaacttaattgtaaatatcatatccagaatcaagaaatacaaatcatatatagcttcaagttagtatcaattctagagnnnnnnnnntcaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44913883 |
gaacaataaacttaattgtaaatatcatatccagaatcaagaaatacaaatcatatatagcttcaagttagtatcaattctagagaaaaaaaaatcaatt |
44913784 |
T |
|
| Q |
201 |
ccaattattatcactccaaacatgtcaaaataaaatttatgtgtctag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44913783 |
ccaattattatcactccaaacatgtcaaaataaaatttatgtgtctag |
44913736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University