View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19932_low_50 (Length: 251)
Name: NF19932_low_50
Description: NF19932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19932_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 42780698 - 42780847
Alignment:
| Q |
1 |
taaaatttaaattcacttcaaagtaattaattattnnnnnnnngatacatgaaattaaatgattggatggtgaaatgctactccaacagccacttctaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780698 |
taaaatttaaattcacttcaaagtaattaaatattaaaaaaaagatacatgaaattaaatgattggatggtgaaatgctactccaacagccacttctaaa |
42780797 |
T |
|
| Q |
101 |
acatcaatgcaatagaagaaaggtagtatgaaaacatagttagtaatatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780798 |
acatcaatgcaatagaagaaaggtagtatgaaaacatagttagtaatatg |
42780847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 184 - 240
Target Start/End: Original strand, 42780916 - 42780972
Alignment:
| Q |
184 |
ggtacacgaacaatttttaaccttacaaatcttcgttttcagttttcgttgcccttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780916 |
ggtacacgaacaatttttaaccttacaaatcttcgttttcagttttcgttgcccttt |
42780972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 160
Target Start/End: Original strand, 42780861 - 42780890
Alignment:
| Q |
131 |
aaaacatagttagtaatatggctctgagat |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42780861 |
aaaacatagttagtaatatggctctgagat |
42780890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University