View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19934_high_37 (Length: 264)
Name: NF19934_high_37
Description: NF19934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19934_high_37 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 16 - 264
Target Start/End: Complemental strand, 10724618 - 10724370
Alignment:
| Q |
16 |
ttaactagtaatgtgttacatctaacggattatacttttctgtgcagcaatttctgaaagatatactgaaagatctttgtgtctacaataacaaaggaac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10724618 |
ttaactagtaatgtgttacatctaacggattatacttttctgtgcagcaatttctgaaagatatactgaaagatctttgtgtctacaataacaaaggaac |
10724519 |
T |
 |
| Q |
116 |
taatcaaggcacctatgagctgaagcctgaatacagaaaaactggcgattagctgcaaataccaatgctcataaaatactaattcaaatcattttttcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10724518 |
taatcaaggcacctatgagctgaagcctgaatacagaaaaactggcgattagctgcaaataccaatgctcataaaatactaattcaaatcattttttcat |
10724419 |
T |
 |
| Q |
216 |
ttactttgatcgagttgtgaaatggagcggcgtgcattttattgatgtt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10724418 |
ttactttgatcgagttgtgaaatggagcggcgtgcattttattgatgtt |
10724370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University