View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19934_high_38 (Length: 261)
Name: NF19934_high_38
Description: NF19934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19934_high_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 46 - 150
Target Start/End: Complemental strand, 28654398 - 28654294
Alignment:
| Q |
46 |
aataattagaaatggttagaatagatcttaagtccacaatggatatagatttcttgcattcacgtaattagagttgccaatttgaacaatcaaattaagt |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28654398 |
aataattagaaatggttagaatagatcttaagtccacaatggatatagatttcttgcattcacgtaattagagttgccaatttgaactatcaaattaagt |
28654299 |
T |
 |
| Q |
146 |
ttcga |
150 |
Q |
| |
|
||||| |
|
|
| T |
28654298 |
ttcga |
28654294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 28654272 - 28654226
Alignment:
| Q |
205 |
gttagatggatcacatgattgtgataaatatatgattttctgatgat |
251 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
28654272 |
gttagacggatcacatgattgtgacaaatatatgattttctaatgat |
28654226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University