View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19934_high_49 (Length: 225)
Name: NF19934_high_49
Description: NF19934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19934_high_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 12 - 132
Target Start/End: Original strand, 53118378 - 53118499
Alignment:
| Q |
12 |
ttattcttaagtttgtatagtgtaaaatagaaattgacgtactgattgatagaaaattatatatttataaaatggcataaacatgctattaaatacgtca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53118378 |
ttattcttaagtttgtatagtgtaaaatagaaattgacgtactgattgatagaaaattatatatttataaaatggcataaacatgctattaaatacgtca |
53118477 |
T |
|
| Q |
112 |
att-aatatattataccgaaac |
132 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
53118478 |
attaaatatattataccgaaac |
53118499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University