View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19934_high_54 (Length: 203)
Name: NF19934_high_54
Description: NF19934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19934_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 15 - 161
Target Start/End: Original strand, 28600798 - 28600952
Alignment:
| Q |
15 |
ataggacatgaaccgtgaatttaatatagtttgacatagaggttcactgaaaat-----caagtacctgatagaagtgattgatctagaaatttggat-- |
107 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600798 |
ataggacatgaaccgtgaatataaaatagtttgacatagaggttcaatgaaaatcaaatcaagtacctgatagaagtgattgatctagaaatttggatta |
28600897 |
T |
 |
| Q |
108 |
-tagtaggggaaatataattattataaatctctacataaaaattaagccaagact |
161 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
28600898 |
gtagtaggggcaatataattattataaatctttacataaaaattaagtcaagact |
28600952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University