View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19934_low_39 (Length: 261)

Name: NF19934_low_39
Description: NF19934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19934_low_39
NF19934_low_39
[»] chr1 (2 HSPs)
chr1 (46-150)||(28654294-28654398)
chr1 (205-251)||(28654226-28654272)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 46 - 150
Target Start/End: Complemental strand, 28654398 - 28654294
Alignment:
46 aataattagaaatggttagaatagatcttaagtccacaatggatatagatttcttgcattcacgtaattagagttgccaatttgaacaatcaaattaagt 145  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
28654398 aataattagaaatggttagaatagatcttaagtccacaatggatatagatttcttgcattcacgtaattagagttgccaatttgaactatcaaattaagt 28654299  T
146 ttcga 150  Q
    |||||    
28654298 ttcga 28654294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 205 - 251
Target Start/End: Complemental strand, 28654272 - 28654226
Alignment:
205 gttagatggatcacatgattgtgataaatatatgattttctgatgat 251  Q
    |||||| ||||||||||||||||| |||||||||||||||| |||||    
28654272 gttagacggatcacatgattgtgacaaatatatgattttctaatgat 28654226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University