View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19934_low_49 (Length: 226)

Name: NF19934_low_49
Description: NF19934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19934_low_49
NF19934_low_49
[»] chr5 (1 HSPs)
chr5 (17-207)||(886770-886960)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 886960 - 886770
Alignment:
17 aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
886960 aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag 886861  T
117 gtaagagattcatatgaaattaagaacaattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatatagag 207  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
886860 gtaagagattcatatgaaattaagaataattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatatagag 886770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University