View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19934_low_54 (Length: 207)
Name: NF19934_low_54
Description: NF19934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19934_low_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 34 - 192
Target Start/End: Complemental strand, 10910745 - 10910584
Alignment:
| Q |
34 |
gagggttatgaacttatgaagcttgtgtagtgtaggaggaagnnnnnnnnnngaatggaaatgaaagtggtt---gagaagttactttatagagaaggaa |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
10910745 |
gagggttatgaacttatgaagcttgtgtagtgtaggaggaagaaaaaaaaaagaatggaaatgaaagtggttattgagaagttaatttatagagaaggaa |
10910646 |
T |
 |
| Q |
131 |
gagtggaacaaaattaataaaggccaaacatacattagcaatcaaattaagggcatggaaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10910645 |
gagtggaacaaaattaataaaggccaaacatacattagcaatcaaattaaaggcatggaaat |
10910584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 89 - 142
Target Start/End: Complemental strand, 10913021 - 10912968
Alignment:
| Q |
89 |
tggaaatgaaagtggttgagaagttactttatagagaaggaagagtggaacaaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| | |||||| |||||| |
|
|
| T |
10913021 |
tggaaatgaaagtggttgagaagttaatttatagagaaaggagagtgaaacaaa |
10912968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University