View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19935_low_3 (Length: 242)
Name: NF19935_low_3
Description: NF19935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19935_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 81 - 198
Target Start/End: Original strand, 193391 - 193508
Alignment:
| Q |
81 |
tttatgaactggccaaaggctcaagctcagcacacatataatcctcttgttccccctcaaagactagaatttggattcgcatcattactcaaaaggctct |
180 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193391 |
tttatgaactgaccaaaggctcaagctcagcacacatataatcctcttgttccccctcaaagactagaatttggattcgcatcattactcaaaaggctct |
193490 |
T |
|
| Q |
181 |
gtgcaacacctataagag |
198 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
193491 |
gtgcaacacctataagag |
193508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 193308 - 193360
Alignment:
| Q |
1 |
tttgaatttaaaattactcttattgttgtgcatgaaatgtatgttaaataata |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
193308 |
tttgaatttaaaattactcttattgttgtgcatgaaatatatgttaaataata |
193360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 195 - 226
Target Start/End: Original strand, 193539 - 193570
Alignment:
| Q |
195 |
agagcttcgtaaccctgacccaactcccatct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
193539 |
agagcttcgtaaccctgacccaactcccatct |
193570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University