View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19937_high_12 (Length: 202)
Name: NF19937_high_12
Description: NF19937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19937_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 171
Target Start/End: Original strand, 1521957 - 1522109
Alignment:
| Q |
16 |
attttgttttgttccgattttttcttcattttgcaggttccttcaagcattcttcatcctggtagatattttatcnnnnnnnnacagtaacatctttttg |
115 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1521957 |
attttgttttgttccgattttttc---attttgcaggttccttcaagcattcttcatcctggtagatattttatcttttttttacagtaacatctttttg |
1522053 |
T |
|
| Q |
116 |
cttttctgcttgaaatttgtatataatcatgttcttattttcacttttgttcaaac |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1522054 |
cttttctgcttgaaatttgtatataatcatgttcttattttcacttttgttcaaac |
1522109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 79
Target Start/End: Complemental strand, 22080764 - 22080708
Alignment:
| Q |
22 |
ttttgttccgattttttcttcattttgcaggttccttcaagcattcttcatcctggta |
79 |
Q |
| |
|
|||||||||| ||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22080764 |
ttttgttccgtttttttcc-catttttcaggttccttcaagcattcttcatcctggta |
22080708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University