View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19937_high_8 (Length: 257)
Name: NF19937_high_8
Description: NF19937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19937_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 124
Target Start/End: Complemental strand, 43232151 - 43232045
Alignment:
| Q |
18 |
atttacacacacacaatagatttgaaattttgaattctaaatcatcttccaagagaatcccaatttagctttctgtgtgtaacaaatatcaagtagaggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43232151 |
atttacacacacacaatagatttgaaattttgaattctgcatcatcttccaagagaatcccaatttagctttctgtgtgtaacaaatatcaagtagaggt |
43232052 |
T |
|
| Q |
118 |
cttatat |
124 |
Q |
| |
|
|| |||| |
|
|
| T |
43232051 |
ctcatat |
43232045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 43232018 - 43231969
Alignment:
| Q |
120 |
tatatacaagtaagatgacccgtaaacataatatgatattatggttttgg |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43232018 |
tatatacaagtaagatgacccataaacataatatgatattatggttttgg |
43231969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University