View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19939_high_17 (Length: 232)
Name: NF19939_high_17
Description: NF19939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19939_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 13 - 151
Target Start/End: Complemental strand, 32553290 - 32553154
Alignment:
| Q |
13 |
agatgaatagcagctccgttcctgtgagtgtcgttaaattttgtatatgttttatatgtgtttgtatcaatttcttgtattgcatgcatgattcgatttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32553290 |
agatgaatagcagctccgttcctgtgagtgtcattaaattttgtatatgttttatatgtgtttgtatcaatttct--tattgcatacatgattcgatttt |
32553193 |
T |
|
| Q |
113 |
cgtttatatgtgtaatctcctgtttaattttattctagc |
151 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32553192 |
cgtttatatgtgtaatctcttgtttaattttattctagc |
32553154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 207
Target Start/End: Complemental strand, 32553154 - 32553113
Alignment:
| Q |
166 |
ctaattgtatgattttgttttcttttgtcattgattaataat |
207 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
32553154 |
ctaattgtatgattttgttttattttgtgattgattaataat |
32553113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University