View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19939_high_9 (Length: 297)
Name: NF19939_high_9
Description: NF19939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19939_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 93 - 277
Target Start/End: Complemental strand, 38545260 - 38545088
Alignment:
| Q |
93 |
gaagcgaattttcaaaaatcattcgttgtttaattagtttagttttttaaaatttatcagaatgagtgaaaaatgtaagcaagaggtaatttgatttcga |
192 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38545260 |
gaagtgaattttcaaaaatcattcgttgtttaattagtttagttttttaa------------tgagtgaaaaatgtaagcaagaggtaatttgatttcga |
38545173 |
T |
|
| Q |
193 |
gattcatgtggaagatttttccgccacttggtccaatatttagacggttcaagcagggaagaaagttccatgtgacagataaata |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38545172 |
gattcatgtggaagatttttccgccacttggtccaatatttagacggttcaagcagggaagaaagttccatgtgacagataaata |
38545088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University