View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19939_low_16 (Length: 246)

Name: NF19939_low_16
Description: NF19939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19939_low_16
NF19939_low_16
[»] chr2 (3 HSPs)
chr2 (133-230)||(25747680-25747777)
chr2 (17-79)||(25747555-25747617)
chr2 (17-79)||(25739151-25739213)


Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 133 - 230
Target Start/End: Original strand, 25747680 - 25747777
Alignment:
133 gaatgagtttgggaacgttgtttggtttgtttacccgccaactacatataaagtggcaacggtttgtgttttgaaccgttactatattttgcactcgt 230  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25747680 gaatgggtttgagaacgttgtttggtttgtttacccgccaactacatataaagtggcaacggtttgtgttttgaaccgttactatattttgcactcgt 25747777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 25747555 - 25747617
Alignment:
17 gggtgggagggctgagaaggtgttttggagagtaccaatcacgatcaagattccacattttgg 79  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25747555 gggtgggagggctgagaaggtgttttggagagtaccaatcacgatcaagattccacattttgg 25747617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 17 - 79
Target Start/End: Original strand, 25739151 - 25739213
Alignment:
17 gggtgggagggctgagaaggtgttttggagagtaccaatcacgatcaagattccacattttgg 79  Q
    ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||    
25739151 gggtgggagggatgaggaggtgttttggagagtaccaatcacgatcaagattccacattttgg 25739213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University