View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19941_high_3 (Length: 373)
Name: NF19941_high_3
Description: NF19941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19941_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 26049585 - 26049802
Alignment:
| Q |
12 |
cacagagtaattatgattattgtaagttttagtagagaacaacacctataggctatagtactgttggtaagttttgcccttctgtgaaaacttgttgtca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
26049585 |
cacagagtaattatgattattgtaagttttagtagagaacaacacctataggctatagtactgttggcaagttttgccctactgtgaaaactggttgtca |
26049684 |
T |
|
| Q |
112 |
agtaatgnnnnnnncttgatacccttgttttgtctca--ttttttattctcctaatgaaaggaggataataagattaatatagaaaaagagagttggtga |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26049685 |
agtaatgtttttttcttgatacccttgttttgtctcatttttttttttctcctaatgaa---aggataataagattaatatagaaaaagagaattggtga |
26049781 |
T |
|
| Q |
210 |
agtgtggtgttttgaatggac |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26049782 |
agtgtggtgttttgaatggac |
26049802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 247 - 373
Target Start/End: Original strand, 26049898 - 26050024
Alignment:
| Q |
247 |
aggcaggtacgacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacacttgacatgacttttgc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26049898 |
aggcaggtacgacgagttggcaattgcacttcttgataaggtgttgctaatttgatatggatttgaatcttctggttttaacactggacatgacttttgc |
26049997 |
T |
|
| Q |
347 |
tgcattggtgggttctgattctatatt |
373 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
26049998 |
tgcattggtgggttctgatcctatatt |
26050024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University