View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19942_high_9 (Length: 202)
Name: NF19942_high_9
Description: NF19942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19942_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 41 - 186
Target Start/End: Original strand, 8563854 - 8563999
Alignment:
| Q |
41 |
atatataacttgtctttcaaattcaaacccagcaacttcacaaggaatggatcatgttcaaatacaaaccaaaacggcactcactcttcattctcactgc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8563854 |
atatataacttgtctttcaaattcaaacccaggaacttcacaaggaatggatcatgttcaaatacaaaccaaaaccgcactcactcttcattctcactgc |
8563953 |
T |
|
| Q |
141 |
ccaaaaacgcttcgttgcattactaccacaccctccttcttcttca |
186 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8563954 |
ccaaaaacgcttcgtagcattactaccacaccctccttcttcttca |
8563999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University