View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19943_high_6 (Length: 342)
Name: NF19943_high_6
Description: NF19943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19943_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 6483659 - 6483447
Alignment:
| Q |
14 |
attgatcaagtctaagcaacacttgaatcttgatctaggtagtgaaatgtgacaggatgagaggaactgtgttaaatgtgatggaatcggtgttggagtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
6483659 |
attgatcaagtctaagcaacacttgaatcttgatctaggtagtgaaatgtgacaggatgagaggaactttgttaaatgtgatggaatctgtgttggagtt |
6483560 |
T |
 |
| Q |
114 |
atcatcttagtgtttgtaagtgaaaaatgtgtgaattgatggtggcaaagatagagacagtcgtgacaagctgcggattggaccgtaaaatacagattta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6483559 |
atcatcttagtgtttgtaagtgaaaaatgtgtgaattgatggtggcaaagatagagacagtcgtgacaagctgcggattggaccgaaaaatacagattta |
6483460 |
T |
 |
| Q |
214 |
agggtggggttct |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6483459 |
agggtggggttct |
6483447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University