View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19943_low_11 (Length: 251)
Name: NF19943_low_11
Description: NF19943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19943_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 31349402 - 31349582
Alignment:
| Q |
1 |
aaaagttaactttatttggttttgctttgaactttccgattggaacgagcatggaaccctacgcagctttgatcacttaagagttaagagagtatccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31349402 |
aaaagttaactttatttggttttgctttgaactttccgattggaacgagcatggaaccctacgcagctttgatcac-------ttaagagagtatccaat |
31349494 |
T |
|
| Q |
101 |
tcttcacaaaagcatagtgacatttctatcaaaatattcnnnnnnngattacttttaaacaaaaaacgtttaaaaattaaagggttca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31349495 |
tcttcacaaaagcatagtgacatttctatcaaaatattctttttttgattacttttaaacaaaaaacgtttacaaattaaagggttca |
31349582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University