View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19943_low_13 (Length: 203)
Name: NF19943_low_13
Description: NF19943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19943_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 193
Target Start/End: Complemental strand, 11034541 - 11034366
Alignment:
| Q |
17 |
aaactgaattgtgataatatattcagaatagcatgttttggtatatatatctaaaactaaaagtgt---ctatactttgcaactgtgactcctccaaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
11034541 |
aaactgaattgtgataatatattcagaatagcatgttttggtatat----ctaaaactaaaagtgtagtctatactttgcaagtgtgactcctccaaaat |
11034446 |
T |
 |
| Q |
114 |
cttctacaataaaaacaaggctaacaatttgtcaatttcaccatcgcaccaatcaactcatatctatactgtgatgatgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11034445 |
cttctacaataaaaacaaggctaacaatttgtcaatttcaccatcgcaccaatcgactcatatctatactgtgatgatgt |
11034366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University