View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19944_high_11 (Length: 227)
Name: NF19944_high_11
Description: NF19944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19944_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 24 - 202
Target Start/End: Complemental strand, 3214584 - 3214406
Alignment:
| Q |
24 |
gagtaagacagaagtttagttcaaagtgtttatgaaagtcaatttcaatatcatcatgctttttccaccgtttgaaaattgaaaaaagtttacacatcta |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3214584 |
gagtaagacagaagtttagttcaaagtgtttatgaaagtcaatttcaatatcatcatgctttttccaccgtttgaaaattgaaaatagtttacacatcta |
3214485 |
T |
 |
| Q |
124 |
aagatcaacgaaatacgaatttcttaccatttcactgtagctgtgatcgaaggagttacatctgaatccgtgaatggtg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3214484 |
aagatcaacgaaatacgaatttcttaccatttcactgtagctgtgatcgaaggagttacatctgaatccgtgaatggtg |
3214406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 66 - 202
Target Start/End: Complemental strand, 3194003 - 3193862
Alignment:
| Q |
66 |
tttcaatatcatcatgctttttccaccgtttgaaaattgaaaaaagtttacacatctaaagatcaacgaaatacgaatttcttaccatttcactgtagct |
165 |
Q |
| |
|
|||||||||||| | ||||| ||| |||||||||| ||||||||||||||||| | ||||||||||||||||||| || |||||| |||| ||||||| |
|
|
| T |
3194003 |
tttcaatatcatgctacttttaccatggtttgaaaatggaaaaaagtttacacatgtgaagatcaacgaaatacgaaattgttaccaattcattgtagct |
3193904 |
T |
 |
| Q |
166 |
gtgat-----cgaaggagttacatctgaatccgtgaatggtg |
202 |
Q |
| |
|
||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
3193903 |
gtgatcgaatcgaaggagttgcatctgaatccatgaatggtg |
3193862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University