View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19944_low_7 (Length: 256)
Name: NF19944_low_7
Description: NF19944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19944_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 51892528 - 51892298
Alignment:
| Q |
1 |
attaggtaccccgattttaatattgttcaagttactctttttatgtgtgttcttctctttacttggggaaagtttactagggttttcaatagttgtttaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51892528 |
attaggtaccctgattttaatattgttcaagttactctttttatgtgtgttcttctctttacttggggaaagtttactagggttttcaatagttgtttaa |
51892429 |
T |
|
| Q |
101 |
atatgtggattaaaaatgtagttggttggataaggtttttgagtagattgggttgtaaaactgcagatagcatactcattaggaaaaggggaatgggtgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
51892428 |
atatgtggattaaaaatgtagttggttggataaggtttttgagtagattgggttgtaaagctgcaggtagcatacacattaggaaaaggggaatgggtgg |
51892329 |
T |
|
| Q |
201 |
ctcaagcctatcagtctacgacaagtatgaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51892328 |
ctcaagcctatcagtctacgacaagtatgaa |
51892298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University