View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19945_low_9 (Length: 340)
Name: NF19945_low_9
Description: NF19945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19945_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 16 - 324
Target Start/End: Original strand, 42301276 - 42301583
Alignment:
| Q |
16 |
ataaattggaatttttaaataaataaatccccccttctttttccccattattcttaactcttgacattatgacagtgttacttattttcatgcatattgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42301276 |
ataaattggaatttttaaataaataaatcccc-cttctttttccccattattcttaactcttcacattatgacggtgttacttattttcatgcatattgc |
42301374 |
T |
|
| Q |
116 |
atgtgttttaacactcttgtttccaaaaatgaatggaacttcaattgtgatgagtttgctatataacattgtcatcggtctgtcacacactaattctttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42301375 |
atgtgttttaacactcttgtttccaaaaatgaatggaacttcaattgtgatgagtttgctatataacattgtcatcggtctgtcacacactaattctttg |
42301474 |
T |
|
| Q |
216 |
ttttattgtaatggaccagatgttcttttccacttcaatatttgcatgacgaccacctcatacaatgctatggtaataatttggttgagatttaagtgag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42301475 |
ttttattgtaatggaccagatgttcttttccacttcaatatttgcacgacgaccacctcatgcaatgctatggtaataatttggttgagatttaagtgag |
42301574 |
T |
|
| Q |
316 |
tgcaaatat |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
42301575 |
tgcaaatat |
42301583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 206 - 304
Target Start/End: Complemental strand, 32355951 - 32355857
Alignment:
| Q |
206 |
taattctttgttttattgtaatggaccagatgttcttttccacttcaatatttgcatgacgaccacctcatacaatgctatggtaataatttggttgag |
304 |
Q |
| |
|
|||||| |||| |||| |||||||||||||||||||| |||||||| || |||||| | ||||||||| ||||| ||| | |||||||||||||| |
|
|
| T |
32355951 |
taattccttgtgttatcataatggaccagatgttctttgccacttcatta-ttgcat---gcccacctcatgcaatgggatgatgataatttggttgag |
32355857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 206 - 257
Target Start/End: Complemental strand, 17922091 - 17922040
Alignment:
| Q |
206 |
taattctttgttttattgtaatggaccagatgttcttttccacttcaatatt |
257 |
Q |
| |
|
|||||| || ||||||| ||||||| ||||||||||||||||||||| |||| |
|
|
| T |
17922091 |
taattccttcttttattataatggatcagatgttcttttccacttcattatt |
17922040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University