View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19946_high_9 (Length: 240)
Name: NF19946_high_9
Description: NF19946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19946_high_9 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 37 - 240
Target Start/End: Complemental strand, 7555668 - 7555465
Alignment:
| Q |
37 |
aaccgtaaccccttcatcatgaaaaggcagagacaacaatcggttgcttcgagaaatacacgtacgaggttcagttctcaaccaaaaagaaccaccgctg |
136 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7555668 |
aaccctaaccccttcatcatgaaaaagcagagacaacaatcggttgcttcgagaaacacacgtacgaggttcagttctcaaccaaaaagaaccaccgctg |
7555569 |
T |
 |
| Q |
137 |
ctttttatttacccgatgaatgttggcaacttgtcttcaaatttctcaacaacggcgacgacaaccgttatttgaagactctctccctcgtttccaaaca |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7555568 |
ctttttatttacccgatgaatgttggcaacttgtcttcaaatttctcaacaacggtgacgacaaccgttatttgaagactctctccctcgtttccaaaca |
7555469 |
T |
 |
| Q |
237 |
gttt |
240 |
Q |
| |
|
|||| |
|
|
| T |
7555468 |
gttt |
7555465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 194
Target Start/End: Complemental strand, 7561390 - 7561329
Alignment:
| Q |
133 |
gctgctttttatttacccgatgaatgttggcaacttgtcttcaaatttctcaacaacggcga |
194 |
Q |
| |
|
|||| |||||||||||| ||||| |||||| ||| ||||||||| || |||||||| ||||| |
|
|
| T |
7561390 |
gctgatttttatttacctgatgactgttggaaacatgtcttcaagttcctcaacaatggcga |
7561329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 6417625 - 6417570
Alignment:
| Q |
142 |
tatttacccgatgaatgttggcaacttgtcttcaaatttctcaacaacggcgacga |
197 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||||||||| ||| |||||||||||| |
|
|
| T |
6417625 |
tatttacccgatgagtgttgggaacttatcttcaaattcatcatcaacggcgacga |
6417570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University