View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19947_high_12 (Length: 365)
Name: NF19947_high_12
Description: NF19947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19947_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-140; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 95 - 347
Target Start/End: Complemental strand, 35364141 - 35363889
Alignment:
| Q |
95 |
ccccgagaaaatccacccagccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatctacttaccgtgattccactcg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364141 |
ccccgagaaaatccacccagccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatctacttaccgtgattccactcg |
35364042 |
T |
 |
| Q |
195 |
aggacgaagacgatgatgaggtcgacccctcatggaacaaaatctaaatctcacattgctcacaacttccactgatccagatgatgttcgactgattgag |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364041 |
aggacgaagacgatgatgaggtcgacccctcatggaacaaaatctaaatctcacattgctcacaacttccactgatccagatgatgttcgactgattgag |
35363942 |
T |
 |
| Q |
295 |
tgggaagattttgagcatgatcttgctaggttatcgagtctctcttctgctct |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35363941 |
tgggaagattttgagcatgatcttgctaggttatcgagtctctcttctgctct |
35363889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 35364223 - 35364175
Alignment:
| Q |
13 |
aatatcatacggtttgtttgttccatccaactgaatccagatagacaca |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35364223 |
aatatcatacggtttgtttgttccatccaactgaatccagatagacaca |
35364175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 115 - 174
Target Start/End: Complemental strand, 35364815 - 35364756
Alignment:
| Q |
115 |
ccattttcccgagaaaatcaccaacacagcacaagaacaacaacaatcaatcgatgatct |
174 |
Q |
| |
|
|||| |||| |||||||||| ||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
35364815 |
ccatattcctgagaaaatcatcaacacaccacaagaacaacaagaatcaattgatgatct |
35364756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University