View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19947_high_23 (Length: 250)
Name: NF19947_high_23
Description: NF19947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19947_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 55162074 - 55162292
Alignment:
| Q |
14 |
aatatatcatcaacactgtgagtcagtccaagctaatcttcacttcagcactcacacttcaaattaaaaacaattt-----ggtgtctcataggtaaggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55162074 |
aatatatcatcaacactgtgagtcagtccaagctaatcttcacttcagcactcacacttcaaattaaaaacaatttaatttggtgtctcataggt----- |
55162168 |
T |
 |
| Q |
109 |
atatattaaaagatatatagaagaatctaattatagttttgtctctctgatttgacagaaaagaaagcgtgccgtcaccgttcatgtatcagaccctaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55162169 |
atatattaaaagatatatagaagaatctaattatagttttgtctctctgatttgacagaaaagaaagcgtgccgtcaccgttcatgtatcagaccctaat |
55162268 |
T |
 |
| Q |
209 |
ggaaagaaattacaaggagcttct |
232 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
55162269 |
ggaaggaaattacaaggagcttct |
55162292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University