View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19947_low_25 (Length: 245)
Name: NF19947_low_25
Description: NF19947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19947_low_25 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 7 - 245
Target Start/End: Original strand, 489717 - 489955
Alignment:
| Q |
7 |
cttggtgtgtttaactgccaaggaggaggatggtttcgcgagataagatcaaacaaatgtgcttctgagttttcacattcggtatcaactaagatcaaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
489717 |
cttggtgtgtttaactgccaaggaggaggatggtttcgcgagataagatcaaacaaatgtgcttctgagttttcacattcggtatcaactaagatcaaca |
489816 |
T |
|
| Q |
107 |
tcaaagacattgaatggaacagtggaaagaatccaattcccattgaaggagttcaagtttttgctttgtatttcagccaagccaagaagctcaaactttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
489817 |
tcaaagacattgaatggaacagtggaaagaatccaattcccattgaaggagttcaagtttttgctttgtatttcagccaagccaagaagctgaaactttt |
489916 |
T |
|
| Q |
207 |
ctctccgtctgaaattgaagaaatctctttggagccatt |
245 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
489917 |
ctctccatctgaaattgaagaaatctctttggagccatt |
489955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University