View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19947_low_5 (Length: 506)
Name: NF19947_low_5
Description: NF19947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19947_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 1e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 7897334 - 7897196
Alignment:
| Q |
17 |
agactcaatatgagttattttttattttgcagcggactcgccaggcggttattttaagaaatttacgaggagaaaagcatcgggggatccatcggagagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897334 |
agactcaatatgagttattttttattttgcagcggacacgccaggcggttattttaagaaattcacgaggagaaaagcatcgggggatccatcggagagc |
7897235 |
T |
 |
| Q |
117 |
tccgattatcgaagtccgactatttccgattggttatct |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897234 |
tccgattatcgaagtccgactatttccgattggttatct |
7897196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 221 - 341
Target Start/End: Complemental strand, 7897129 - 7897009
Alignment:
| Q |
221 |
gtctaacttttcttaatgttttatattgcagggtgattatgagtgctttggatcgttgttgagagagagaggaagtaagatgttttgcattgaacatcat |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897129 |
gtctaacttttcttaatgttttatattgcagggtgattatgagtgctttggatcgttgttgagagagagaggaagtaagatgttttgcattgaacatcat |
7897030 |
T |
 |
| Q |
321 |
cattcggcatctaactgctgc |
341 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
7897029 |
cgttcggcatctaactgctgc |
7897009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 406 - 490
Target Start/End: Complemental strand, 7896944 - 7896860
Alignment:
| Q |
406 |
gtacgtgtaactaaatgggtcaaatgatggggtctgtcgcagcatattgagccaatgcttcatgagattctgaggatgtaaagga |
490 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7896944 |
gtacgtataactaaatggctcaaatgatggtgtctgtcgcagcatattgagccaatgcttcatgagattctgagggtgtaaagga |
7896860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University