View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19948_low_1 (Length: 550)
Name: NF19948_low_1
Description: NF19948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19948_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 1e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 20 - 90
Target Start/End: Original strand, 27795169 - 27795239
Alignment:
| Q |
20 |
gttggttcatttatacccatgttaagttaaatgatcttacatgatttaatcttcataaataaacaactttt |
90 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
27795169 |
gttggctcatttatacccatgttaagttaaatgatcatacttgatttaatcttcataaataaacaactttt |
27795239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University