View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19948_low_7 (Length: 297)
Name: NF19948_low_7
Description: NF19948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19948_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 280
Target Start/End: Complemental strand, 28113100 - 28112825
Alignment:
| Q |
5 |
agctctgatatcagtgatgattattcggttaaaggagcatacagtaacaatttactttcagaggattttaatttacctcttactggtagtgtgaaacttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
28113100 |
agctctgatatcagtgatgattattcggttaaaggagcatacagcaacaatttactttcagaggatcgtaatttacctcttactgatagtgtgaaacttt |
28113001 |
T |
|
| Q |
105 |
atcttggtggtgtttgagacatcaagttaaaagttttaattatggtttaatccaatggtgggataatcctaccgaattccttggaagtgtagctgggaat |
204 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28113000 |
atcttggtggtggttgagacatcaagttaaaggttttaattatggtttaatccaatggtgggataatcctaccaaattccttggaagtgtagctgggaat |
28112901 |
T |
|
| Q |
205 |
tgattttgccggtgctgcggctatttcacatgcttcacagtattgggtctggtgtggtgggtgatagatggttact |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28112900 |
tgattttgccggtgctgcggctatttcacattcttcacagtattggttctggtgtggtgggtgatagatggttact |
28112825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University