View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19949_low_12 (Length: 203)
Name: NF19949_low_12
Description: NF19949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19949_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 25 - 125
Target Start/End: Original strand, 25093834 - 25093934
Alignment:
| Q |
25 |
tgtgtctgattcaatacttcatagctacatatttatgattgatatttatcaaaataaatttggtaacgcttatatttattgtgaaacaattccctgaata |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25093834 |
tgtgtctgattcaatacttcatagctacatatttatgattgatatttatcaaaataaatttggtaatgcttatatttattgtgaaacaattccctgaata |
25093933 |
T |
|
| Q |
125 |
t |
125 |
Q |
| |
|
| |
|
|
| T |
25093934 |
t |
25093934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 108 - 197
Target Start/End: Original strand, 25093946 - 25094035
Alignment:
| Q |
108 |
aaacaattccctgaatatcatacaatatttttgcagaatgaaaatactaatggacaccacaagaatgtcaagttcatgtgtgatgatgtc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25093946 |
aaacaattccctgaatatcatacaatatttttgcagaatgaaaatactaatggacaccacaagaatgtcaagttcatgtgtgctgatgtc |
25094035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University