View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19949_low_6 (Length: 288)
Name: NF19949_low_6
Description: NF19949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19949_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 15 - 280
Target Start/End: Complemental strand, 25769168 - 25768903
Alignment:
| Q |
15 |
acaaaggtcatgaaaatcaaaataagcacatcataaaattataaaatttgaaggtagacttgaaatgtatacctaaaatttaacggagtgtgtatcgagt |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25769168 |
acaaaggtcatgaaaaccaaaataagcacatcataaaattataaaatttgaaggtagacttgaaatgtatacctaaaatttaacggagtgtgtatcgagt |
25769069 |
T |
 |
| Q |
115 |
aatcttcattg-ttcnnnnnnngttgttgtcaattttaagttcgtttggcaaaatctagttaagaacnnnnnnnnnnaaggaaaaatctagttaagaact |
213 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25769068 |
aatcttcattgtttttttttttgttgttgtcaattttaagttcgttaggcaaaatctagttaagaac-tttttttttaaggaaaaatctagttaagaact |
25768970 |
T |
 |
| Q |
214 |
tatagcagatagtttgatatgttatatttgataacaattttttctcacaaatttataacatattctt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
25768969 |
tatagcagatagtttgatatgttatatttgataacaattttttctcacaaatttttaacattttctt |
25768903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University