View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19949_low_7 (Length: 257)
Name: NF19949_low_7
Description: NF19949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19949_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 16453134 - 16453386
Alignment:
| Q |
1 |
tgtttttacagattgtaacagagagacctcagaaaaatcaggctatggtgttatcttcatccattctcacattgacccaacctccacctgctgatgcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16453134 |
tgtttttacagattgtaacagagagacctcagaaaaatcaggctatggtgttatcttcatccattctcacattgacccaacctccacctgctgatgcaga |
16453233 |
T |
|
| Q |
101 |
aaaaggcctagcccgtcaaccaatacttctacctatgagtcctttggaggatgtggtaggagaaacttcaaaaagtgttagagaggatggagaagtttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16453234 |
aaaaggcctagcccgtcaaccaatacttctacctatgagtcctttggaggatgtggtaggagaaacttcaaaaagtgttagagaggatggagaagtttat |
16453333 |
T |
|
| Q |
201 |
gatattacaattcaaaatgggattgaaagatgtcatgagaatgatgatgtcca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16453334 |
gatattacaattcaaaatgggattgaaagatgtcatgagaatgatgctgtcca |
16453386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 110 - 219
Target Start/End: Complemental strand, 16349769 - 16349663
Alignment:
| Q |
110 |
agcccgtcaaccaatacttctacctatgagtcctttggaggatgtggtaggagaaacttcaaaaagtgttagagaggatggagaagtttatgatattaca |
209 |
Q |
| |
|
||||| |||||||||||||| | || ||| |||||||||||||| ||||||||||||| ||||||| | ||||| |||||||||| ||||||| |
|
|
| T |
16349769 |
agcccctcaaccaatacttccaattaagaggcctttggaggatgtcaaaggagaaacttcaggaagtgttccaaaggat---gaagtttatgctattaca |
16349673 |
T |
|
| Q |
210 |
attcaaaatg |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
16349672 |
gttcaaaatg |
16349663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 44 - 89
Target Start/End: Complemental strand, 16349841 - 16349796
Alignment:
| Q |
44 |
tatggtgttatcttcatccattctcacattgacccaacctccacct |
89 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
16349841 |
tatggtgttatctttgcccattctcacgttgacccaacctccacct |
16349796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University