View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1994_high_15 (Length: 240)
Name: NF1994_high_15
Description: NF1994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1994_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 19 - 129
Target Start/End: Complemental strand, 8707680 - 8707569
Alignment:
| Q |
19 |
taaattcatcaa-caaaataaatttatttaccttcaatattcacattgtgcaaactttaagaccctaaattgatcgtcaaattaatccctcaaacattta |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
8707680 |
taaattcatcaaacaaaataaatttatttaccttcaatattcacattgtgcaaattataagaccctaaattgatcgccaaattaatcaaacaaacattta |
8707581 |
T |
|
| Q |
118 |
aatgtcatcaca |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8707580 |
aatgtcatcaca |
8707569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 200
Target Start/End: Complemental strand, 8699359 - 8699280
Alignment:
| Q |
124 |
atcacaactgtctttacagaaaactatagtgat---atagaaggacaaatttggctactacattgtatcttttataagct |
200 |
Q |
| |
|
||||||| |||||||||||||||||| |||| | || |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8699359 |
atcacaattgtctttacagaaaactaaagtggtgagatggaaggacaaatttggctactactttgtatcttttataagct |
8699280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University