View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1994_high_5 (Length: 413)
Name: NF1994_high_5
Description: NF1994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1994_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 17 - 398
Target Start/End: Complemental strand, 45459842 - 45459461
Alignment:
| Q |
17 |
caccggtgaaactactggaactggcgataccacaggcataggcactggaactataactggtgctgcaactggcactggtgataccactggcacaggagct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459842 |
caccggtgaaactactggaactggcgataccacaggcataggcactggaactataactggtgctgcaactggcactggtgataccactggcacaggagct |
45459743 |
T |
 |
| Q |
117 |
ggaataggtgaaacaacaggagccggagaaggagcatgtgatgtggcattggaggaagcaagcaaagatggtggcaaaatgacagtgctgatctgcacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459742 |
ggaataggtgaaacaacaggagccggagaaggagcatgtgatgtggcattggaggaagcaagcaaagatggtggcaaaatgacagtgctgatctgcacca |
45459643 |
T |
 |
| Q |
217 |
ctgaaatattgtatggttgtgccacaacagctttaaccaaattggcacctgttccattaggatcagaaggagaggtaaaagtgacagcacctgtgctaag |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459642 |
ctgaaatattgtatggttgtgccacaacagctttaaccaaattggcacctgttccattaggatcagaaggagaggtaaaagtgacagcacctgtgctaag |
45459543 |
T |
 |
| Q |
317 |
atctgtgactttcatgaaaccttccgatcccttagcttgtccactggattgaaacaatgtgctgacagttatgggttgattt |
398 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45459542 |
atctgtgactttcatgaaaccctccgatcccttagcttgtccactggattgaaacaatgtgctgacagttataggttgattt |
45459461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University