View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1994_low_11 (Length: 316)

Name: NF1994_low_11
Description: NF1994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1994_low_11
NF1994_low_11
[»] chr7 (1 HSPs)
chr7 (198-301)||(15324114-15324217)
[»] chr8 (1 HSPs)
chr8 (19-114)||(31499322-31499419)
[»] chr5 (1 HSPs)
chr5 (197-309)||(11787848-11787960)


Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 198 - 301
Target Start/End: Complemental strand, 15324217 - 15324114
Alignment:
198 tgagaaatgcttcttagcacgacatttttgatgcacaacaacactcgaactattccacaccgtttgatgcatgtatttacttttactaattaattttctc 297  Q
    |||||||||||||||||||||||||||||||||||| ||||||| |||||||||| || ||||| ||||||||||||| |||||||||||||||| ||||    
15324217 tgagaaatgcttcttagcacgacatttttgatgcacgacaacacacgaactattcaacgccgttggatgcatgtatttccttttactaattaattctctc 15324118  T
298 tctc 301  Q
    ||||    
15324117 tctc 15324114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 31499419 - 31499322
Alignment:
19 agaaacactttcag--gtggcttgtcgaggatgacttttgacatgatttttaggatttttcatatgacggtcccttgctgaaaattaattataaaaaa 114  Q
    ||||||||||||||  |||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
31499419 agaaacactttcagaggtggcttgtcgaggatgactttttcaatgatttttaggatttttcatatgacggtcccttgctgaaaattaatgataaaaaa 31499322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 197 - 309
Target Start/End: Complemental strand, 11787960 - 11787848
Alignment:
197 ttgagaaatgcttcttagcacgacatttttgatgcacaacaacactcgaactattccacaccgtttgatgcatgtatttacttttactaattaattttct 296  Q
    |||||||||||||||| |||||||| ||   |||||| ||||||| ||||| |||||||||| || ||||||| ||||| |||||||| |||||||||||    
11787960 ttgagaaatgcttcttggcacgacaattgatatgcacgacaacacacgaaccattccacaccattggatgcatatatttccttttacttattaattttct 11787861  T
297 ctctcctatgctt 309  Q
    |||||| ||||||    
11787860 ctctcccatgctt 11787848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University