View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1994_low_11 (Length: 316)
Name: NF1994_low_11
Description: NF1994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1994_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 198 - 301
Target Start/End: Complemental strand, 15324217 - 15324114
Alignment:
| Q |
198 |
tgagaaatgcttcttagcacgacatttttgatgcacaacaacactcgaactattccacaccgtttgatgcatgtatttacttttactaattaattttctc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||| || ||||| ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
15324217 |
tgagaaatgcttcttagcacgacatttttgatgcacgacaacacacgaactattcaacgccgttggatgcatgtatttccttttactaattaattctctc |
15324118 |
T |
|
| Q |
298 |
tctc |
301 |
Q |
| |
|
|||| |
|
|
| T |
15324117 |
tctc |
15324114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 31499419 - 31499322
Alignment:
| Q |
19 |
agaaacactttcag--gtggcttgtcgaggatgacttttgacatgatttttaggatttttcatatgacggtcccttgctgaaaattaattataaaaaa |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31499419 |
agaaacactttcagaggtggcttgtcgaggatgactttttcaatgatttttaggatttttcatatgacggtcccttgctgaaaattaatgataaaaaa |
31499322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 197 - 309
Target Start/End: Complemental strand, 11787960 - 11787848
Alignment:
| Q |
197 |
ttgagaaatgcttcttagcacgacatttttgatgcacaacaacactcgaactattccacaccgtttgatgcatgtatttacttttactaattaattttct |
296 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||| ||||||| ||||| |||||||||| || ||||||| ||||| |||||||| ||||||||||| |
|
|
| T |
11787960 |
ttgagaaatgcttcttggcacgacaattgatatgcacgacaacacacgaaccattccacaccattggatgcatatatttccttttacttattaattttct |
11787861 |
T |
|
| Q |
297 |
ctctcctatgctt |
309 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
11787860 |
ctctcccatgctt |
11787848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University