View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1994_low_16 (Length: 240)

Name: NF1994_low_16
Description: NF1994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1994_low_16
NF1994_low_16
[»] chr8 (2 HSPs)
chr8 (19-129)||(8707569-8707680)
chr8 (124-200)||(8699280-8699359)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 19 - 129
Target Start/End: Complemental strand, 8707680 - 8707569
Alignment:
19 taaattcatcaa-caaaataaatttatttaccttcaatattcacattgtgcaaactttaagaccctaaattgatcgtcaaattaatccctcaaacattta 117  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||   ||||||||||    
8707680 taaattcatcaaacaaaataaatttatttaccttcaatattcacattgtgcaaattataagaccctaaattgatcgccaaattaatcaaacaaacattta 8707581  T
118 aatgtcatcaca 129  Q
    ||||||||||||    
8707580 aatgtcatcaca 8707569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 124 - 200
Target Start/End: Complemental strand, 8699359 - 8699280
Alignment:
124 atcacaactgtctttacagaaaactatagtgat---atagaaggacaaatttggctactacattgtatcttttataagct 200  Q
    ||||||| |||||||||||||||||| |||| |   || |||||||||||||||||||||| ||||||||||||||||||    
8699359 atcacaattgtctttacagaaaactaaagtggtgagatggaaggacaaatttggctactactttgtatcttttataagct 8699280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University